Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , Expression of Adrb1, Adrb2, Adrb3 and Crem in TEX cells at day 45 p.i. with LCMV clone 13. Data from Bioproject PRJNA497086. TEX prog , CD101 − TIM3 − ; TEX eff , CD101 − TIM3 + ; TEX term , CD101 + TIM3 + . b , Annotation of TEX subsets and Adrb1 expression based on scRNA-seq data (NCBI Gene Expression Omnibus (GEO) database identifier GSE122713 , day 28 clone 13). c , ADRB1 expression on gp33 + CD8 + T cells in LCMV Armstrong (day 8, n = 6), clone 13 (day 30, n = 7) and naive CD8 + T cells ( n = 6), pooled from 3 independent experiments. One-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. d , Gene set enrichment analysis using gene ontology adrenergic receptor signalling pathway and day 45 LCMV clone 13 data from PRJNA497086. e , Serum noradrenaline levels of mice infected with LCMV clone 13 at day 7 and day 21 p.i., and of naive mice ( n = 5 mice per group, pooled from 2 independent experiments). Mann–Whitney test. f , Expression of ADRB1 and other canonical TEX genes in CD8 + T cells isolated from HIV-infected donors and from uninfected donors. Data from GSE157829 . g , ADRB1 expression on PD-1 − and PD-1 + CD8 + T cells in the blood of HIV-infected donors ( n = 4) and of uninfected donors ( n = 2). Paired Student’s t -test. h , Flow plots showing CD8 + T cells in the blood of a HIV-infected donor. Red frame indicates ADRB1 + cells. i , Expression of exhaustion markers on ADRB1 − (black) versus ADRB1 + (red) CD8 + T cells in the blood of HIV-infected donors ( n = 4) and uninfected donors ( n = 2). Paired Student’s t -test. j , Representative image of WT P14 + cells (cyan) and CD101 expression (magenta) in the spleen at day 14 p.i. with LCMV clone 13. TH (yellow) was used as a marker for sympathetic nerves. k , Quantification of the shortest distance to the TH signal for CD101 + P14 + cells versus CD101 − P14 + cells calculated from 4 different splenic regions of 2 different mice. ×20 objective. Dashed line indicates the median distance of CD101 − P14 + cells to the TH signal. Linear mixed model. Boxplots show the median. The lower and upper hinges correspond to the first and third quartiles, respectively. The upper whisker extends from the hinge to the largest value no further than 1.5 times the interquartile range (IQR) from the hinge. l , Representative images of nerves within PDAC tumours with T cell clusters (representative of five individual tumours). ×40 objective. m , Distances of CD8 + T cell subsets to TH + nerves in PDAC tumours, pooled from five individual tumours. Kruskal–Wallis test with Dunn’s multiple comparisons test. Dotted line indicates the median. n , Representative images of human NSCLC samples with low and high local TH expression. o , Density of exhausted CD8 + TILs in human NSCLCs with low (bottom 80%, n = 130) and high TH (top 20%, n = 34) expression. Mann–Whitney test. Unless otherwise specified, mean ± s.e.m. is indicated in scatter plots. Two-sided statistical tests were used. **** P < 0.0001, *** P < 0.001, ** P < 0.01, * P < 0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Infection, Expressing, Gene Expression, MANN-WHITNEY, Isolation, Marker, Whisker Assay

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , Cytokine production by P14 + cells with Adrb1 OE and control EV RV-transduced P14 + cells ( n = 3 individual experiments) stimulated with gp33 in the presence or absence of 10 μM adrenaline or noradrenaline. Ordinary one-way ANOVA with Dunnett’s multiple comparisons test. NS, not significant. b , CellTrace Violet (CTV) staining of Adrb1 OE P14 + cells and control EV RV-transduced P14 + cells cultured for 3 days with or without 10 μM adrenaline or noradrenaline. One out of three experiments is shown. Plots gated on congenic + GFP + CD8 + T cells. c , d , Experimental setup ( c ) and representative calcium flux plots ( d ). Adrb1 OE P14 + cells and EV control P14 + cells were cultured in the presence or absence of catecholamines and the calcium flux was measured after TCR stimulation with CD3 crosslink or gp33 stimulation using indo-1 staining. One out of four experiments is shown. Plots gated on congenic + GFP + CD8 + T cells. e , Western blot showing phosphorylation of PLCγ1 in Adrb1 OE and EV control P14 + cells after TCR stimulation in the presence or absence of noradrenaline. Western blot is representative of one out of seven independent experiments quantified in the bottom panel. Wilcoxon test. For source data, see Supplementary Fig. 1 . f , g , Frequency ( f ) and phenotype (PD-1 + TIM3 + ; g ) of Adrb1 OE P14 + cells on day 7 p.i. with LCMV clone 13. n = 10,000 Adrb1 OE P14 + cells and EV P14 + cells each were transferred into recipient mice at a 1:1 ratio ( n = 11, pooled from 3 independent experiments). Wilcoxon test. h , cAMP levels in Adrb1 OE P14 + cells and EV P14 + cells on day 7 p.i. with LCMV clone 13 ( n = 11, pooled from 3 independent experiments). Wilcoxon test. i , cAMP levels in gp33 + CD8 + T cells from mice infected with LCMV Armstrong (day 8 p.i.), LCMV clone 13 (day 30 p.i.) or from naive cells (CD44 − CD8 + T cells). n = 5 mice per group, representative of 1 out of 2 independent experiments. cAMP levels in ADRB1 + and ADRB1 − gp33 + CD8 + T cells on day 30 p.i. with LCMV clone 13 ( n = 13 per group, pooled from 2 independent experiments). CREM expression in gp33 + CD8 + T cells from mice infected with LCMV Armstrong (day 8 p.i., n = 4) or LCMV clone 13 (day 30 p.i., n = 5) or from naive cells (CD44 − CD8 + T cells, n = 4, representative of 1 out of 3 independent experiments). CREM expression in ADRB1 + and ADRB1 − gp33 + CD8 + T cells on day 30 p.i. with LCMV clone 13 ( n = 10 per group, pooled from 2 independent experiments). Kruskal–Wallis test with Dunn’s multiple comparisons test or Wilcoxon test. j , Left, cAMP levels in subsets of exhausted gp33 + CD8 + T cells. PD-1 − cells; TEX prog , TIM3 − PD-1 + ; TEX eff , CX3CR1 + TIM3 + PD-1 + ; TEX term , CD101 + TIM3 + PD-1 + . n = 13 per group, pooled from 2 independent experiments. Right, CREM expression in subsets of exhausted gp33 + CD8 + T cells. PD-1 − , PD-1 − cells; TEX prog , TCF1 + PD-1 + ; TEX eff , CX3CR1 + TIM3 + PD-1 + ; TEX term , CD101 + TIM3 + PD-1 + . n = 8 per group, pooled from 2 independent experiments. Friedman test with Dunn’s multiple comparisons test. k , Representative overlay histogram of CREM expression in Adrb1 KO and control cells. Representative of two independent experiments. Unless otherwise specified, mean ± s.e.m. is indicated in scatter plots. Two-sided statistical tests were used. **** P < 0.0001, *** P < 0.001, ** P < 0.01, * P < 0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Control, Staining, Cell Culture, Western Blot, Phospho-proteomics, Infection, Expressing

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , Experimental setup. Adrb1 fl/fl Gzmb cre+ and Adrb1 fl/fl Gzmb cre– P14 + cells with different congenic markers were mixed at a 1:1 ratio with 7,500 P14 + cells of each genotype co-adoptively transferred into B6 recipients that were infected with LCMV clone 13 one day later. Flow data for day 7 and day 40 were each pooled from 3 independent experiments. b , Frequency of Adrb1 cKO P14 + and WT P14 + cells at day 7 and day 40 p.i. with LCMV clone 13. n = 9 for day 7, n = 16 for day 40. Paired Student’s t -test. c , Expression of TOX on Adrb1 cKO P14 + and WT P14 + cells at day 7 p.i. ( n = 9) and day 40 p.i. ( n = 16). Paired Student’s t -test. d , Representative flow plots gated on P14 + CD8 + T cells showing KLRG1 and CD127 expression of Adrb1 cKO P14 + cells and WT P14 + cells at day 7 p.i. with LCMV clone 13. e , Quantification of CD127−KLRG1 + Adrb1 cKO P14 + cells and WT P14+ cells at day 7 p.i. ( n = 9). Paired Student’s t -test. f – h , Expression of TIM3, CD101, CD39, CXCR6, CX3CR1 and TCF1 on Adrb1 cKO P14 + cells and WT P14 + cells ( f ) and quantification of exhaustion subsets ( g , h ) at day 40 p.i. ( n = 16). Paired Student’s t -test. i , Granzyme B production of Adrb1 cKO P14 + cells and WT P14 + cells at day 40 p.i. ( n = 16). Paired Student’s t -test. j , Viral titres from the spleen of Adrb1 cKO ( n = 10) and WT P14 + recipients ( n = 9) at day 30 p.i. with LCMV clone 13, pooled from 2 independent experiments. Unpaired Student’s t -test. FFU, focus forming unit. k , Frequency of Adrb1 cKO P14 + cells and WT P14 + cells after treatment with anti-PD-L1 or IgG2B from day 23 to day 36. Frequency assessed at day 36 p.i. with LCMV clone 13. Values shown as ratio to mean WT IgG2B, n = 5 per group pooled from 2 independent experiments. Mixed effects-analysis with Dunnett’s multiple comparisons test. l , cAMP levels (left) and CREM expression (right) in Adrb1 cKO P14+ cells and WT P14 + cells at day 40 p.i. ( n = 16). Paired Student’s t -test. m , Left, representative image of Adrb1 cKO P14 + cells and WT P14 + cells in the spleen at day 31 p.i. TH staining was used as a marker for sympathetic nerves. Right, quantification of the shortest distance to nerve staining for Adrb1 cKO P14 + cells and WT P14 + cells calculated from six different splenic regions of two different mice. Image collected using a ×10 objective. Linear mixed model. Boxplots show the median. The lower and upper hinges correspond to the first and third quartiles, respectively. The upper whisker extends from the hinge to the largest value no further than 1.5 times the IQR from the hinge. Unless otherwise specified, mean ± s.e.m. is indicated in scatter plots. Two-sided statistical tests were used. **** P < 0.0001, *** P < 0.001, ** P < 0.01, * P < 0.05. MFI, mean fluorescence intensity.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Infection, Expressing, Staining, Marker, Whisker Assay, Fluorescence

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , LCMV clone 13-infected mice were left untreated or treated with atenolol throughout the infection and analysed at day 37 p.i. Data are pooled from 3 independent experiments, n = 7 per group. Mann–Whitney test. Flow plot gated on CD8 + T cells. b , Frequency of TEX prog , TEX eff and TEX term subtypes of gp33 + CD8 + T cells in mice treated with atenolol ( n = 7) or without treatment ( n = 7), pooled from 3 independent experiments. Mann–Whitney test. c , Flow plot gated on CD8 + T cells, depicting cytokine production of CD8 + T cells in mice treated with atenolol or without treatment at day 37 p.i. after antigen-specific stimulation with gp33 for 6 h. d , Cytokine production of CD8 + T cells in mice treated with atenolol ( n = 8) or without treatment ( n = 8) at day 37 p.i. after stimulation with gp33 for 6 h, pooled from 3 independent experiments. Mann–Whitney test. e , f , cAMP ( e ) and CREM ( f ) levels in gp33 + CD8 + T cells at day 37 p.i. in untreated mice and mice treated with atenolol. Histograms show representative cAMP staining (left, e ) and bar graphs show cumulative data from 3 independent experiments ( e , n = 10 or 14 mice per group) or CREM staining ( f ) from 2 independent experiments ( n = 4 mice per group). Mann–Whitney test. g , Viral titres in the serum of LCMV clone 13-infected mice treated with atenolol ( n = 10) or without treatment ( n = 8), pooled from 3 independent experiments. Mann–Whitney test. h , Flow plots (left) and quantification (right, n = 17 each, pooled from 3 independent experiments) of ADRB1 expression by TEX isolated from YUMMER1.7 tumours implanted into WT B6 mice. Plots gated on the indicated cell populations. Friedman test with Dunn’s multiple comparisons test. PD-1 − , PD-1-negative CD8 + . i , Experimental setup for YUMMER1.7 tumour experiments. j , Normalized tumour mass of YUMMER1.7 tumours relative to IgG control (IgG n = 14, atenolol n = 9, ICB n = 12, atenolol + ICB n = 13, pooled from 3 independent experiments). Plot shows median with IQR. Kruskal–Wallis test with Dunn’s multiple comparisons test. k , Flow plots depicting IFNγ and TNF production by CD8 + T cells isolated from YUMMER1.7 tumours following stimulation with phorbol 12-myristate-13-acetate (PMA) and ionomycin for 5 h. Plots gated on CD8 + T cells. l , Cytokine production by CD8 + T cells after stimulation with PMA and ionomycin (IgG n = 10, atenolol n = 9, ICB n = 7, atenolol + ICB n = 8, pooled from 2 independent experiments). Kruskal–Wallis test with Dunn’s multiple comparisons test. Unless otherwise specified, mean ± s.e.m. is indicated in scatter plots. Two-sided statistical tests were used. **** P < 0.0001, *** P < 0.001, ** P < 0.01, * P < 0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Cell Function Assay, Infection, MANN-WHITNEY, Staining, Expressing, Isolation, Control

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , ADRB1 expression on TEX subsets ( n = 9, pooled from 2 independent experiments). One-way ANOVA with Friedman test. PD-1 − , PD-1-negative CD8 + ; TEXprog, SLAMF6 + PD-1 + CD8 + ; TEX eff , CX3CR1 + TIM3 + PD-1 + CD8 + ; TEX term , CD101 + TIM3 + PD-1 + CD8 + . b , Experimental setup. c , Tumour volume of PDAC tumours determined by ultrasound (IgG n = 9; propranolol n = 9; ICB n = 10; propranolol + ICB n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, pooled from two independent experiments. d , Normalized tumour mass of PDAC tumours relative to IgG control (IgG n = 21; propranolol n = 18; ICB n = 19; propranolol + ICB n = 24). Ordinary one-way ANOVA with Holm–Šídák’s multiple comparisons test. Pooled from five independent experiments. Colours same as c . e , Tumour volume determined by ultrasound in mice treated with isotype control ( n = 5), propranolol and ICB ( n = 5) or propranolol and ICB with CD8 + depletion ( n = 7). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, pooled from two independent experiments. f , Frequency of CD8 + T cells, expression of exhaustion markers and production of cytokines after stimulation with PMA and ionomycin (IgG n = 17; propranolol n = 13; ICB n = 14; propranolol + ICB n = 18 for CD8, PD-1, TIM3; IgG n = 7, propranolol n = 8; ICB n = 10; propranolol + ICB n = 9 for SLAMF6; IgG n = 12 propranolol n = 10 ICB n = 9, propranolol + ICB n = 14 for IFNγ and granzyme B, pooled from 4 independent experiments). Kruskal–Wallis test with Dunn’s multiple comparisons test. g , UMAP dimensional reduction of scRNA-seq data from PDAC tumours coloured by cell types. DCs, dendritic cells; ILCs, innate lymphoid cells; NK, natural killer. h , UMAP depicting eight T cell clusters within the T cell cluster identified in g . Stacked bar graphs depict the frequency of T cell clusters in different treatment conditions. TFH, follicular helper; TReg, regulatory. i , Heatmap of manually selected marker genes used for cell type annotation as depicted in h . j , Gene signature analysis in CD8 + T cells using AUCell. Gene signatures for T cell exhaustion and TRM cells were obtained from ref. 50 and ref. 45 , respectively. Boxplots show the median. The lower and upper hinges correspond to the first and third quartiles, respectively. The upper whisker extends from the hinge to the largest value no further than 1.5 times the IQR from the hinge. k , Heatmap of manually selected cytokines and chemokines in different treatment conditions. l , Venn diagram depicting upregulated genes in CD8 + T cells in the indicated treatment conditions versus IgG control. Numbers in the Venn diagram indicate the number of upregulated genes. Unless otherwise specified, mean ± s.e.m. is indicated in scatter plots. **** P < 0.0001, *** P < 0.001, ** P < 0.01, * P < 0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Expressing, Control, Marker, Whisker Assay

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , Volcano plot depicting genes upregulated in terminal exhausted cells vs in progenitor exhausted cells respectively. Data from PRJNA497086, TEX prog = CD101 − TIM3 − , TEX eff = CD101 − TIM3 + , TEX term = CD101 + TIM3 + . b , Frequency of ADRB1 expressing cells within the different exhausted subsets depicted at d30 p.i. with LCMV clone 13. PD-1 − = PD-1 − P14 + , TEX prog = TCF1 + PD-1 + P14 + , TEX eff = CX3CR1 + TIM3 + PD-1 + P14 + , TEX term = CD101 + TIM3 + PD-1 + P14 + . N = 7 per subset pooled from 2 independent experiments, Friedman test with Dunn’s multiple comparisons test. c , Representative flow plots depicting ADRB1 expression on naïve CD8 + T cells (CD44 − ) and gp33 + CD8 + T cells from mice infected with LCMV Armstrong (d8) and LCMV clone 13 (d30), representative of 3 independent experiments. d , Representative overview image of WT P14 + cells (cyan), CD101 expression (magenta), and tyrosine hydroxylase (yellow) at d14 p.i. in the spleen of a recipient mouse infected with LCMV clone 13. Four different regions such as this were imaged across the spleens of two different mice from 2 independent experiments and the shortest distance to TH signal for CD101 + P14 + cells vs CD101 − P14 + cells was calculated. Image collected using ×20 objective tiled across a 3×3 region. e + f , Representative images of nerves within PDAC tumors with T cell clusters (representative of 5 individual tumors from 2 independent experiments). Scale bar: 50 μm. Image was collected using a ×40 objective tiled across the entire PDAC tumor within the pancreas, with 1.5 μm z step sizes to acquire a 30 μm imaging depth. g , Density of TH + stromal cells across 164 primary human NSCLCs. h , Density of CD8 + TILs in NSCLCs with low (bottom 80%, n = 130) and high TH (top 20%, n = 34) expression. Mann-Whitney test. Unless otherwise specified, mean ± SEM is indicated in scatter plots. Two-sided statistical tests were used. **** indicates a p value < 0.0001, ***<0.001, **<0.01, *<0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Expressing, Infection, Imaging, MANN-WHITNEY

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , Verification of Adrb1 overexpression. qPCRs were performed in duplicates. b , Flow plots of cytokine production by Adrb1 OE P14 + cells and control empty vector (EV) P14 + cells. Cells were stimulated with gp33 in the presence or absence of 10 μM adrenaline (A) or noradrenaline (NA). Plots are gated on GFP + CD8 + T cells and indicative of one of 3 independent experiments. c , Cytokine production by control empty vector (EV) retroviral (RV)-transduced P14 + cells (n = 3 individual experiments). Cells were stimulated with gp33 in the presence or absence of 10 μM A or NA. d , Representative flow plots depicting frequency of Adrb1 overexpressing (OE) P14 + cells and control (EV) P14 + cells at d0 and d6 of culture. Cells were mixed at a 1:1 ratio and cultured for 6 days total with and without the addition of 10 μM A or NA. Representative of 4 independent experiments. e , Ratio of Adrb1 OE P14 + cells to control (EV) P14 + cells over 6 days of culture. Cells were mixed at a 1:1 ratio and cultured for 6 days total with and without the addition of 10 μM A or NA. Quantification from 4 independent experiments. Unless otherwise specified, mean ± SEM is indicated in scatter plots.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Over Expression, Control, Plasmid Preparation, Retroviral, Cell Culture

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , Verification of knockout in Adrb1 fl/fl Granzyme B Cre+ mice ( Adrb1 cKO). Splenocytes were isolated and stimulated with anti-CD3/CD28. Cells were cultured in vitro for 4 days with IL-2 and subsequently CD8 + T cells were sorted. Adrb1 expression was assessed with qPCR performed in triplicates. b , Expression of PD-1 on Adrb1 cKO P14 + cells (red) and WT P14 + cells (black) at d7 p.i. (n = 9) and d40 p.i. (n = 16). Paired t -test. Flow data for both d7 and d40 are each pooled from 3 independent experiments. c , Cytokine production of Adrb1 cKO P14 + cells (red) and wild type P14 + cells (black) at d40 p.i. after 6 h stimulation with gp33. N = 16, paired t -test, pooled from 3 independent experiments. d , Viral titers in spleen from Adrb1 cKO and WT P14 + recipients at d36 p.i. with LCMV clone13 and treated with antiPD-L1 or IgG2B from d23-d36 p.i. Ordinary one-way ANOVA with Holm–Šídák’s multiple comparisons test with a single pooled variance. WT IgG2B n = 7, WT anti-PD-L1 n = 8, cKO IgG2B n = 8, cKO anti-PD-L1 n = 8, pooled from 2 independent experiments. e , Verification of Crem knockdown using sh Crem and qPCR performed in triplicates to determine Crem expression. Splenocytes were transduced with sh Crem or sh Cd19 as control and cultured for 3 days before sorting on Ametrine + CD8 + T cells. Unpaired t -test. f , Frequency and phenotype of Crem knockdown P14 + and control knockdown P14 + at d7 p.i. with LCMV clone 13. 15,000 Crem knockdown P14 + cells and control knockdown P14 + cells each were mixed at a 1:1 ratio and transferred into recipient mice that were infected with LCMV clone 13 on the same day (n = 15, pooled from 3 independent experiments). Wilcoxon test. g , Representative image of Adrb1 cKO P14 + (red) and WT P14 + cells (cyan) at d31 p.i. in the spleen of a recipient mouse infected with LCMV clone 13. Image is representative of 3 independent regions and 2 independent experiments. B220 stain in blue and F4/80 stain in grey. Image was collected using a ×20 objective tiled across a 3×3 region. Unless otherwise specified, mean ± SEM is indicated in scatter plots. Two-sided statistical tests were used. **** indicates a p value < 0.0001, ***<0.001, **<0.01, *<0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Knock-Out, Isolation, Cell Culture, In Vitro, Expressing, Knockdown, Transduction, Control, Infection, Staining

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a + b , Absolute cell counts of gp33 + CD8 + T cells ( a ), and of different exhausted subsets of gp33 + CD8 + T cells ( b ) isolated from the spleens of mice treated with atenolol or control water during chronic infection with LCMV clone 13, assessed at d37 p.i. (n = 7 per group, pooled from 3 independent experiments). Mann-Whitney test. c , Absolute cell counts of cytokine producing cells after antigen-specific stimulation with gp33. Cells were isolated from the spleens of mice treated with atenolol or control water during chronic infection with LCMV clone 13, assessed at d37 p.i. (n = 8 per group, pooled from 3 independent experiments). Mann-Whitney test. Unless otherwise specified, mean ± SEM is indicated in scatter plots. Two-sided statistical tests were used. **** indicates a p value < 0.0001, ***<0.001, **<0.01, *<0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Isolation, Control, Infection, MANN-WHITNEY

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , Flow plots depicting ADRB1 expression by different subsets of exhausted T cells isolated from MC38 tumors, plots are gated on the indicated cell populations (left panel). Quantification of ADRB1 expression on different subsets of exhausted CD8 + T cells isolated from MC38 tumors implanted into wild type B6 mice (right panel, n = 16 each, pooled from 3 independent experiments). Friedman test with Dunn’s multiple comparisons test. b , cAMP levels in ADRB1 − vs ADRB1 + CD8 + T cells isolated from MC38 tumors (left panel, n = 8), Wilcoxon test was used to determine statistical significance. cAMP levels in different subsets of exhausted CD8 + T cells isolated from MC38 tumors (right panel, n = 8 each). Friedman test with Dunn’s multiple comparisons test. Data pooled from 2 independent experiments. PD-1 − = PD-1 − CD8 + , TEX prog = TIM3 − PD-1 + CD8 + , TEX eff = CX3CR1 + TIM3 + PD-1 + CD8 + , TEX term = CD101 + TIM3 + PD-1 + CD8 + . c , Expression analysis of the indicated exhaustion markers in ADRB1 high and ADRB1 low CD8 + T cells in RNA Seq data generated from 16 human colorectal cancer samples. Data from GSE200997 . Statistics were calculated using a linear mixed model. Boxplots show median. The lower and upper hinges correspond to the first and third quartiles. The upper whisker extends from the hinge to the largest value no further than 1.5 * IQR from the hinge. d , cAMP levels in ADRB1 − vs ADRB1 + CD8 + T cells isolated from YUMMER tumors (n = 4), Wilcoxon test was used to determine statistical significance. cAMP levels in different subsets of exhausted CD8 + T cells isolated from YUMMER tumors (n = 4 each). Friedman test with Dunn’s multiple comparisons test. Data representative of one of 2 independent experiments. PD-1 − = PD-1 − CD8 + , TEX prog = TIM3 − PD-1 + CD8 + , TEX eff = CX3CR1 + TIM3 + PD-1 + CD8 + , TEX term = CD101 + TIM3 + PD-1 + CD8 + . e , Normalized tumor mass of YUMMER tumors from mice under the indicated treatment conditions relative to IgG control (IgG n = 9, atenolol + ICB n = 8, atenolol + ICB + CD8 + depletion n = 9), pooled from 2 independent experiments. Kruskal-Wallis Test with Dunn’s multiple comparisons test. f , ADRB1/ADRB2 selectivity of atenolol and CGP 20712A according to ref. 35 . g , Schematic of the experimental setup used in the subsequent figure panels showing YUMMER tumor experiments (left panel). Normalized tumor mass of YUMMER tumors relative to IgG control (IgG n = 5, CGP 20712A n = 7, ICB n = 8, CGP 20712A + ICB n = 8, pooled from 2 independent experiments). Kruskal-Wallis Test with Dunn’s multiple comparisons test (right panel). h , Flow cytometric assessment of production of cytokines by CD8 + T cells after stimulation with PMA/ionomycin (IgG n = 5, CGP 20712A n = 7, ICB n = 8, CGP 20712A + ICB n = 7, pooled from 2 independent experiments). Kruskal-Wallis Test with Dunn’s multiple comparisons test. Unless otherwise specified, mean ± SEM is indicated in scatter plots. Two-sided statistical tests were used. **** indicates a p value < 0.0001, ***<0.001, **<0.01, *<0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Cell Function Assay, Expressing, Isolation, RNA Sequencing, Generated, Whisker Assay, Control

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , Representative flow cytometry plots depicting ADRB1 expression of different CD8 + T cell subsets in PDAC tumors implanted into wild type B6 mice. Plots are gated on the indicated cell populations and representative of 2 independent experiments. b , Expression analysis of the indicated exhaustion markers in ADRB1 high and ADRB1 low CD8 + T cells in RNA Seq data generated from 16 human pancreatic cancer samples. Data from GSE155698 . Statistics were calculated using a linear mixed model. Boxplots show median. The lower and upper hinges correspond to the first and third quartiles. The upper whisker extends from the hinge to the largest value no further than 1.5 * IQR from the hinge. Two-sided statistical tests were used. **** indicates a p value < 0.0001, ***<0.001, **<0.01, *<0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Flow Cytometry, Expressing, RNA Sequencing, Generated, Whisker Assay

Journal: Nature

Article Title: The β 1 -adrenergic receptor links sympathetic nerves to T cell exhaustion

doi: 10.1038/s41586-023-06568-6

Figure Lengend Snippet: a , cAMP levels in ADRB1 − vs ADRB1 + CD8 + T cells isolated from PDAC tumors (left panel, n = 6 pooled from 2 independent experiments), Wilcoxon test. cAMP levels in different subsets of exhausted CD8 + T cells isolated from PDAC tumors (second to left panel, n = 6 each pooled from 2 independent experiments). Friedman test with Dunn’s multiple comparisons test. PD-1 − = PD-1 − CD8 + , TEX prog = TIM3 − PD-1 + CD8 + , TEX eff = CX3CR1 + TIM3 + PD-1 + CD8 + , TEX term = CD101 + TIM3 + PD-1 + CD8 + . CREM expression in ADRB1 + vs ADRB1 − CD8 + T cells isolated from PDAC tumors (second to right panel, n = 6 pooled from 2 independent experiments), Wilcoxon test. CREM expression in different subsets of exhausted CD8 + T cells isolated from PDAC tumors (right panel, n = 10 each, pooled from 3 independent experiments). Friedman test with Dunn’s multiple comparisons test. PD-1 − = PD-1 − CD8 + , TEX prog = SLAMF6 + PD-1 + CD8 + , TEX eff = CX3CR1 + TIM3 + PD-1 + CD8 + , TEX term = CD101 + TIM3 + PD-1 + CD8 + . b , Normalized tumor mass of PDAC tumors relative to IgG control (IgG n = 5, atenolol n = 5, ICB n = 5, atenolol + ICB n = 5), representative of 2 independent experiments. Kruskal-Wallis Test with Dunn’s multiple comparisons test. c , ADRB1/ADRB2 selectivity of atenolol and ICI 118551 according to ref. 35 (left panel). Normalized tumor mass of PDAC tumors relative to IgG control (IgG n = 9, ICI 118551 n = 9, ICB n = 8, ICI 118551 + ICB n = 10), pooled from 2 independent experiments. ICI 118551 hydrochloride was administered at 0.2 μg/g i.p. daily. Kruskal-Wallis Test with Dunn’s multiple comparisons test. Unless otherwise specified, mean ± SEM is indicated in scatter plots. Two- sided statistical tests were used. **** indicates a p value < 0.0001, ***<0.001, **<0.01, *<0.05.

Article Snippet: Adrb1 KO was performed in naive P14 + cells using mouse Adrb1 guide from Synthego TGGCCATCGCCAAGACCCCG, a Lonza 4D Nucleofector and a protocol modified from a previous publication 54 .

Techniques: Isolation, Expressing, Control

Journal: Circulation Research

Article Title: Wnt4/β-Catenin Signaling Induces VSMC Proliferation and Is Associated With Intimal Thickening

doi: 10.1161/circresaha.110.233999

Figure Lengend Snippet: Figure 4. Wnt4 protein and mouse VSMCs proliferation. A, Representative Western blots for Wnt2 and Wnt4 in qui- escent (Q) vs proliferating (P) (20 ng/mL PDGF for 24 hours) VSMCs (n 4). -Tubulin is shown as loading control. B, Representative Western blot and quanti- fication of Wnt4 protein in CM collected from VSMCs treated for 24 hours with SFM, PDGF-BB, or basic fibroblast growth factor (b-FGF). *P0.05, signifi- cant difference from SFM (n 3). C and D, BrdUrd (red) and Wnt4 (green) dual immunocytochemistry on quiescent (C) and proliferating (PDGF-stimulated) (D) VSMCs. Nonimmune IgG (IgG) was used as negative control (E and F). Scale bar represents 10 m. G, Proliferation (BrdUrd incorporation) was quantified 24 hours after addition of 20 ng/mL PDGF and transfection of control, Wnt2, or Wnt4 SI (n 4). *P0.05, significant dif- ference from control SI.

Article Snippet: Chinese Hamster Ovary (CHO) cells were transfected with 2 g of mouse Wnt4 plasmid (17995, Addgene) or with 2 g of green fluorescent protein (GFP) control plasmid (VSC 1001, Amaxa Inc) using a Nucleofector device and a CHO kit (VCA-1002, Amaxa Inc).

Techniques: Western Blot, Control, Immunocytochemistry, Negative Control, Transfection

Journal: Circulation Research

Article Title: Wnt4/β-Catenin Signaling Induces VSMC Proliferation and Is Associated With Intimal Thickening

doi: 10.1161/circresaha.110.233999

Figure Lengend Snippet: Figure 5. Wnt4 promotes VSMC proliferation. A, Quiescent mouse VSMCs were treated with CM collected from CHO cells transfected with either GFP (GFPCM, control) or Wnt4 plasmid (Wnt4CM) and 10 mol/L BrdUrd. Proliferation was assessed by BrdUrd incorporation after 24 hours (n 4). *P0.05, significant difference from GFPCM. B, Quiescent mouse VSMCs were treated with 500 ng/mL recombinant Wnt2 and/or Wnt4 and 10 mol/L BrdUrd. Proliferation was assessed by BrdUrd incorporation after 24 hours (n 4). *P0.05, significant difference from SFM control. C, Quiescent TOPgal mouse VSMCs were treated for 24 hours with 500 ng/mL Wnt2 or Wnt4, and -catenin signaling was quantified by quantifica- tion of -galactosidase protein (n 3). *P0.05, significant difference from control untreated VSMCs. D, Representative Western blots for active -catenin (ABC -catenin), total -catenin, cyclin D1, and GAPDH (loading control) 12 hours after treatment with either GFPCM or Wnt4CM. E, Mouse VSMCs were treated with Wnt4CM and 10 mol/L BrdUrd for 24 hours with or without 500 ng/mL DKK-1. The number of BrdUrd-positive (proliferating) VSMCs was quantified (n 4). *P0.05, significant difference from Wnt4CM alone. F, Proliferation (BrdUrd incorporation) was quantified 24 hours after addition of 500 ng/mL Wnt4 to VSMCs transfected with control, Fzd1, or Fzd6 SI (n 4). *P0.05, significant difference from control SI.

Article Snippet: Chinese Hamster Ovary (CHO) cells were transfected with 2 g of mouse Wnt4 plasmid (17995, Addgene) or with 2 g of green fluorescent protein (GFP) control plasmid (VSC 1001, Amaxa Inc) using a Nucleofector device and a CHO kit (VCA-1002, Amaxa Inc).

Techniques: Transfection, Control, Plasmid Preparation, Recombinant, Western Blot

Journal: Circulation Research

Article Title: Wnt4/β-Catenin Signaling Induces VSMC Proliferation and Is Associated With Intimal Thickening

doi: 10.1161/circresaha.110.233999

Figure Lengend Snippet: Figure 6. Wnt4 protein in balloon injured rat carotid arteries. Rat carotid arteries were subjected to balloon injury to induce VSMC proliferation and intimal thickening. Immunohistochemistry for Wnt4 (green) (A through H) and BrdUrd (red) (E and F) or cyclin D1 (red) (G and H) was performed on sham control carotid arteries or carotid arteries removed at 2 and 10 days after injury (n 6). Nuclei are stained blue with DAPI (A through D). Dotted lines indicate the intimal:medial boundary, and solid lines indicate the medial:adventitial boundary. Scale bar, 25 m. Nonimmune IgG is negative control.

Article Snippet: Chinese Hamster Ovary (CHO) cells were transfected with 2 g of mouse Wnt4 plasmid (17995, Addgene) or with 2 g of green fluorescent protein (GFP) control plasmid (VSC 1001, Amaxa Inc) using a Nucleofector device and a CHO kit (VCA-1002, Amaxa Inc).

Techniques: Immunohistochemistry, Control, Staining, Negative Control

Journal: Circulation Research

Article Title: Wnt4/β-Catenin Signaling Induces VSMC Proliferation and Is Associated With Intimal Thickening

doi: 10.1161/circresaha.110.233999

Figure Lengend Snippet: Figure 7. Role of Wnt4 in intimal thick- ening. Intimal lesion area was quantified 21days after carotid ligation of Wnt4/

Article Snippet: Chinese Hamster Ovary (CHO) cells were transfected with 2 g of mouse Wnt4 plasmid (17995, Addgene) or with 2 g of green fluorescent protein (GFP) control plasmid (VSC 1001, Amaxa Inc) using a Nucleofector device and a CHO kit (VCA-1002, Amaxa Inc).

Techniques: Ligation